Science has two rules: (a) everything you know is wrong (q.v. Firesign Theatre and (2) facts adjust themselves to fit theories and philosophies, not the other way around. Which is why Derrida is having such a heyday right now. Anyway, the second most important socially contextualized scientist EVER is of course Mr. Charles Darwin, who invented out of his own mind a small archipelago inhabited by weird birds and lizards, and likewise created a hermaphroditic barnacle (do you really think a puritanical Creator would have made such disgusting things? Maybe s/he was just lazy). I don't even want to know why Darwin would discover (that is, visualize and thus create in our consensual reality) such loathsome creatures. Nevertheless, that is what he found, and we are stuck with it, until someone more inventive comes along. Why couldn't someone imagine silk trees that giver rise to fruit that look like Salma Hayek once in a while? Is that too much to ask?


It has been postulated that El Físico Nuclear's Bungalow of Solitude was created out of the bones of mammoths which roamed the plains of California when The Physicist arrived here just after the creation of the earth (roughly 4000 BC). Most the above statement is true: in fact, he bought those mammoth bones from The Bone Room, the finest site in cyber- or waking time-space to purchase the bodies of our extinct and not-so-extinct relatives. And every schoolboy knows that the earth is at least 8000 years old, but who's counting?

It has been suggested that El Físico Nuclear was behind some of the most monumental actions of our national hero, Thomas Jefferson. It has been whispered in the Oval Office (no one knows by whom) that it was The Physicist who suggested that Jefferson buy the Louisiana Territories from Napoleon, to keep the French naturalist Buffon from the Philosopher's Stone buried in New Orleans. Again, El Físico Nuclear convinced Jefferson that the Great Chain of Being was a metaphysical atemporal construct which actually existed, in a vain attempt to teach Jefferson the concept and structure of DNA (had he understood this idea, perhaps he would have prevented his hypocrisy from coming to light). It was this belief in the Great Chain of Being which led, indirectly, to the Lewis and Clark expedition. The theory of the Great Chain cannot be held in the mind at the same time as the idea of extinction of a species--indeed, these concepts cannot even co-exist in the same sentence (whoops). This incompatibility is due to the fact that the Great Chain theory holds that every species is a link in the chain, and that the Creator would not allow any part of this continuum to be lost. Given this premise, it was a logical conclusion that the remains of mammoths found in Virginia had living relatives on the plains of America, somewhere. Lewis and Clark were sent to investigate the lands to the west, and Jefferson hoped that these behemoths would be found there.






Dr. Science is indeed a true son of El Físico Nuclear. Not in the sense that he carries The Physicist's genfo--at least, not more than any of us do--but in that he explains science in a way that makes sense to everyone. The fact that he, like Stanton Friedman, has only a Master's degree, and is therefore not a real doctor, is perhaps the reason that he can explain such ideas as the Aurora Borealis, quarks, and Spam in ways that we can all understand. Furthermore, he also occasSionaly features information on turning your home into a laboratory. So go ahead--Ask Dr. Science!


Cecil Adams also features science for everyone. Though his answers to questions sometimes take the skeptical approach, he nonetheless will field any question, no matter how improbable it might be to the bigwigs in their ivory towers and white coats. If you have ever wondered how much the oceans contribute to the density of daylight, if this density is depreciable over a land-filled earth, or what would happen if we were to paint everything black, get The Straight Dope!



One of the problems with science today is that it is just too expensive. The men in white lab coats will tell you that experiments require huge cyclotrons and heavy water and generators and so forth. In fact, the secrets of the universe can be discovered with nothing more than a magnetic compass, a mirror or sundial, and three dice. Other experiments can be performed at home with household cleaners and cookware. Finally, an individual has determined a way to explain Darwin's theory of evolution with user friendly M&M's candy from a local store! This is science as El Físico Nuclear practices it--knowledge for everyone!

We all know that the universe contains a code which is inscribed in our genetic information (by none other than El Físico Nuclear, of course). I have provided a link to a website, located at ACGGCAGCAGCCTTGAGTCTGCTGGTGGTGGTGTAGATAGGTACCTCTGGGTAGAGCGTCGATCTGTTGATATTGGGTTTGACCCCAGTCCCAAGAGGCACCGATCTG, which pretends that its intent is to allow us to encode messages into DNA code, but real purpose of which is to decode our genfo. Type your own unique genome in and find out what the universe is trying to say to you!


The Borderlands Science Research Foundation deserves an award for longevity and for careful investigation of knowledge outside mainstream science.




Charles Hoy Fort was a diligent, if bemused, chronicler of anomalous phenomena. The Fortean Times is likewise diligent.




Unfortunately, no one has seen fit to convert Fort's works to electronic text as yet, but there are generous snippets at this Fortean webpage.

This is a well done bibliography of Fort's work.



Like the title says: Fate Magazine carries TRUE reports of the Unknown! It features material relevant to the El Físico Nuclear Paradigm once in a great while.

Strange Magazine is slicker and more trendy, but just as insightful!

The Ecker's UFO Magazine and Phenomena Report Online. This journal is dedicated to uncovering the government conspiracy to silence witnesses, and holds to the hardware vision of the UFO.


A short history of our awareness of UFOs and those responsible for this knowledge is found on this webpage, maintained by brotherblue.


The Unmuseum takes a look at paranormal and cryptozoological phenomenon.



TABLE OF HYPERLINKS

© 1998 efn_archivist@geocities.com


OFFICIAL MEMBER
You may use this as a banner to link to this page.

Member of the Science Humor Webring
[ Previous 5 Sites | Previous | Next | Next 5 Sites ]
[ Random Site | List Sites ]



This page hosted by GeoCities Get your own Free Home Page
1 1